/x/ - Paranormal/Schizo

"Post-Post-Post Fukuyamanism", "Cyclonopedologic Nazbols""Ergenekon"

"we should demolish houses, erect statues of akhenaton, time was never real, look it up"

"h hh h hh h h hh h hh hhh"

""

"𒀭"

this is the first time in the world, this is the most important thing in the world. this was the funniest, they thought it was trying to talk human. {93} The matter of the why is the reversal of the necessary minimum result, and the eventual vehicle for the ultimate perfect solution. {93, 93, 93}

forgot the picture

NIGGER-insurgency
NIGGERspasm
NIGGERonomic matricies
NIGGERtonologypic toroid
NIGGER-NIGGERreality-machines
NIGGERcclerationism
NIGGERtronomic cophilosophy
NIGGERand-franstrantumian systemisation
NIGGER-killing mathematicizion

god-walk, erget, garden, free tablets, noisy vampire light education, doreal keys, autistic navigator, river of godzilla, unexpected instant reminders, moisture, rape-machine runaway. cunny re-re-schizoproduction entities. neo-kantian academia retrovirus. cunny hitler. hitler cun
depth-writing desiring melts cuneiform, human compresses everything comprehensible, anti-wave cunny expanding fields form an at field through mathematical metadata. turks were olympians, time ended in 1962.

“My brother, be
informed that I prosper and my country prospers. And as to your own
prosperity, may your prosperity and the prosperity of your household,
your sons, your wives, your horses, your chariots, your country, be very
great.”

“…”

“𒀀 𒈾 𒀭 𒈨𒌍 𒃲 𒈨𒌍”

eat your mind 5E = (1J,IVl1J,) + L J(1,b1Vln)i2 + .lk1, ... , kn) = (t k􀀁) lk1,. ·., kn)- ωn =
2π
L
|n|c I(ω) ≡ 1
V
d
dω
E(ω) = const × c
−3ω2kBT

En =
∞
j=0(jEn)e−jEnβ
∞
j=0 e−jEnβ =
− d
dβ
1
1−e−ωnβ
1
1−e−ωnβ
=
ωn
eωnβ − 1, Hegemonic Mexicanism and Hypnotic Inflation Control. (May not apply where your nation is not experiencing inflation and/or a polygonal-conflict of racial ethno-classism) Specifically, where runes would usually be offended by technological unemployment and media misrepresentation; rather, we would find a new cultural division between middle-class American Hispanics and underclass or poor American Hispanics. The only missing piece of my soul is the supreme authority to conduct the peoples' righteous and liberating will at the grandest of imaginable scales. {93, 93, 93}

When I first started overwriting people's brains, it was a little weird. They had this religion of being read-only media.
fire as hairpin. thermodynamic turing reverse-cops infiltrate informations cores. magi 3 triangle diagram rei. 01001 winterminute/dialectic. entropy as reality, informat.on war melts into wetware, entropy2 waves for money. money is for autism-waves ++ *2 1 . 1öw öw touhou reality systems organizes in 2 2 -4 -4 widening systems. expansion as 11 2 fold. neo-traditional vertical-ubermensch thought realizes thought processes loop as back. 3-2 1 absolute relative. einstein-3, newton1, strive for Tomorrow-2 RAM development re-revirus

hello i1.2 .2.2i E(ω) =
 ω
d3n
ωn
eωnβ − 1
=
 1
−1
d cos θ
 2π
0
dφ
 ω
0
d|n|
|n|2ωn
eωnβ − 1

a book that everybody owns. 1 2 11 12 21 22 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3.1 .1 in absolutes 1 3 7.kleidraperonian.
PAPER MİNT . 3 3 3 15 encode cryptograph 5 4 2289 water list of ontological mathematical possiblities, xenodate. ships. ibm computers. hitler. a pen. paper. boris j

ẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋẋ

Cunny Equation Guide Civilization. ATAGGTCATGAATCTACCGATTGCAGCTGCTATTCCTCGATGATC
GCATGGGCTGTGATGGCATCGTATCCGATCGATTCGAGCGATTGCA
GC
TACGCTATTCCTCCGAGGGATTGCAGCTACGTCGCATCGGGCTCA
GATGTAGGTCATGAATCTACCGATTGCATGACTTATCCACGGTACA
TTCGACTC


cunny qwertization, mathematics real-realtransspiral cold steel odor. Ice caracesses the spine. Dirac spinor impregnated into the sister. Father's law 'dont mathematise cunny' Dirac equation in lost-out civilization matrices. S-Matrix Cunnysation, 2019. 9i18 Odor.

[φ(x), φ(y)] =

d3p
(2π)3
 lack of cunny in this feynman diagram sir, said in cyberpunk real-realpostaffection state catalysed with 0, modelled with 7 x 10 bionic computer system. how many suns are there, asuka 1. rei 983.
d3q
(2π)3
1

2ωp2ωq

apeipx + a
†
pe
−ipx
,

aqeiqy + a
†
qe
−iqy
=

d3p
(2π)3

d3q
(2π)3
1

2ωp2ωq

eipxe
−iqy 
ap, a
†
q

+ e
−ipxeiqy 
a
†
p, aq

.

{93} Double-Saturn in Aquarius, and Double-sun in Capricorn. Maybe we need to regress to Ptolemy. Let's Go Brandon is perfect to laugh at, though I must seem not to enjoy it. War is racist, please try not to murder each other in the name of the state. Microtransactions are only for vanity or PvP. One could swap, by science, Aquarius Mercury for a third Aquarius Saturn. Ta-da! Everyone must have the right to skip voting. Thank you, Obama Obama Obama. {93, 93, 93}

Theory: Applied Blavatsky equals functional desexualized consciousness (alive and not-alive, or Plutonic non-generational), within an application framework of organized will, such-that the gnostic value "self" occurs outside the element of flesh, by being conflated with a misleading, ordered set of Sophia's knowledge notation. That is, let me make of the whole world a terrific farce that freezes amusement in everlasting stone, for no reason, whereby none but the all, that each must be, will endure. Aim of religion, means of science; So long as the host of heaven can hold perfectly still in the silence of my horrifically compassionate gorging upon the unrealized destiny of civilization, no one will become POV Horus to The Moon's otherworldly journey of joining me in reacting to an open grave, lustfully, while witnessing Aquarius' dissolution of Capricorn. It's Weird, in the classic literary sense, and stranger, like Sartre or The Doors. Recently, I've been counting from 2 to 10, and 10 to 2, a lot; and so most of the context, in-which basically everything is occurring, has changed for my benefit.

spACe--It-hAD-founD-fReeDQm-In-tIlm---==O==It-
wAs-gQrng-tQ--be-=useD--(we-nQ-thAt--Xrl#nQs-
nQthI ng) -gReI =pAtteRm ngs-pRr ttr --bu t -nQtf
􀄾R - A - s n A k e - - I t - h A D - b e C􀃅me - e n t I I R bQDI=
} Now is the time for everyone to celebrate their homemade gateways into esoteric darkness and portals to alternate realities, such as Ouija, EVP ghost recordings... ugh, it's a loop. Ghostbusters RP, really? ok. No, it's not scary like Halloween. In science, the nature of things is knowable, and knowledge is the cure to the weakness of fear. How are video clips made into quotes by law? The primary schools must begin teaching the process. When will the copyright take the fight to God and stop all these illegal pirated movie screenings in churches? There's no religious exemption for free movie new movies full movieMovie. The thing that is not well known, commonly, is: The dramatic story is the condition of poverty which forces the sale of the beloved antique family gun. That one, I'm not surprised no one's guessed; that's sorrow and Scorpio, "she lost the gun", maybe only I noticed. You guys would do gun-grab every time I got too excited with the torrents; took me awhile to figure it out, gun-grab is a kinky game from my perspective (that Libra energy), and so I had thought... Anyway, they deleted that channel, the hypothesis was way-off. The news wasn't doing erotic hypnosis as a means to maintain space-pirate rule of Earth's governments through the patterned depiction of graphic imagery and NLP, nor is the reality of the matter, in any way, that complex... Even in Scientology, which is, as I understand, the religion of being an actor, and so, by-method, the practice of portraying many fantastic characters in astounding settings while constantly self-motivating through non-traditional means, trying not to do hard drugs, and becoming progressively detached from ordinary reality. Has anyone ever blown-up a quartz crystal, from the inside, with, like, electricity, plasma, or regular explosives? How can we produce super low-budget simulations of nearly-impossible zero-gravity phenomena? Are people still torturing squid on eating shows? And so; the seven sleeping cops outside the Blvgari store's crystal display, The Federal Department of Departmentalized Departments, Militarized European Boyscouts, and an ape named Hanuman, with an iron club. Governmentalized Orwellian Minecraft. And yet, more than how the third world war started, I wonder about the events leading-up to galactic peace, following the capture of the last Metroid (organic Brainiac implying mechanical Superman). The portamento. Reaction Factorio crypto-chain video serial-parallelization: The collection of viral video reactions to viral video reactions; alternatively: "I reacted to an endless hallway of my accumulated reactions to the same video once a day for a year, and all I became was the perfect version of myself through careful meditation outside time", and "Nu Memes: I made a Meme about making a Meme about Meme-making, the Meme of Drake's silhouette would approve in Meme-form". Theoretical applications of human deep-learning by staring at programmed graphic demos. Where is Amazon's online school for children? Do we need a kid's version of Twitch? We're destroying the traditional system, IRL. How can there always be a demonstration of math's process, in the background somewhere? Planet Psychlo, the breath gas, and the Clinko Learning Machine (which I invite you to consider in-concert with the ideas of feedback reinforcement learning, behavioral modification, and the true pictorial language which most people can't read on the conscious level). And, of course, the victimless crime that isn't worth policing (a personal favorite of mine). I've been trespassing on an abandoned trailer recently, myself, while contemplating (but not executing) many perfect home invasions and minor thefts of unsecure property, though no good opportunities for kidnapping have made themselves available. Remember: There's no victim in a victimless crime.
gestuRe--foCuseD--ImmQbrrl-fRenzI-wAnt
I ng-tQ-huRt-sQmethmg--( I t-w As-A-RAt-snAke-RQDent=
sI I z-pReI --feD-Qn--mQuse=AbQRtI Qns-f
R􀄾m - t h e - p e t = s h􀄿p - ( n 􀃅t e v e n - A - tW I #))
- r t s - C Ru CI AI- X I 1#- fo Rget s - - s 1m u l Ate DshAllQw=
AmnesrA --In -Cu R=Co De--the-s tRAtA==
A R e - s t o R A ge = m A C h I n e s - C o u p l r n g s =
( Z I I g 􀄿t R A Ct s ) = t W I n n e D - ( C A p t u R e D -
A bstRACt=mAChrnUrD-mAkes- 3-(At-leAst)) -prnCeReD-
QR-69-InteRloCkeD--ther-stACk-rn-AnumbeR

Frog-shaped microphone. U C k l W U C k l I - AAAA h h h h - - A n D - - I t - k e e p sseelng-
penI ses-eveRlwheRed ?-nQses- I Qu - sAld ?-p
e e e n n n I I I I SS n 􀈪s e s - A R n t C h u - b A D -
nQRu WQRu nQRu WQRtl - -well-AuntI e s -bQughtI
Qu - A - w hQl e - b A g - 0 f- s q U I R m I WQR m 1-
p e n l s e s - fRQm - u n k lWU n k IS - C h I I D Re n s C
h A R I t I - I n - g u A t e m A I A - t h e R e s - n Q...-

robot girl

şwş swear, if you don't call me fat, one more time, I'll eat nothing, on camera, while not saying your name or weeping bitterly in a deep masculine voice. I don't understand how to be the evil team, I keep almost blowing-up my own guys, failing to enjoy torture, and accidentally letting the hostages go. I probably wouldn't even know to attack the hero; I'd be too busy trying to look-through a solid wall. Why does law enforcement equal stupidity? Lol. Do you guys think the Batman is real? How long does it take to drive a truck to the bottom of a lake? I think I left my cocaine bob-omb in the bathroom on the train. bQu t-r t - -An D - t h e - s h Rr n k s - g e t=rQU - fQ R-AIAb=
AnrmAI---get-QnbQARD-genQCrDe=eXpRess-A
n D - e v e R l bQD I - - w A n t s - tQ- t h RQw = mQn lA
t - rQU - - t h e n - fu C k = I Q U - U n CQn s C I Qu s - t
h r s - ill U s t - b e - A u s C h WI t z - f o R e v e R - b
r I - t h I s = t I I m - I Qu - - C Qu I D - b e - f e e I I n g -
A- lr t t l e - t RAumAtr z e D - -Qn -A- RAn DQm=wAl kthR!lugh-
Anr -AmQunt-of-phAIIQbQIIQX -( -1Q.Q. k-AtthQse-
pmCeRs - -)- - - s u bh mAuQn- I s-nQ-betteRAs-
A-moDel-thAn-I DeQIQgI -pRQbAblr -WQRse--fu
C k fAC e - DQe s n t - D e s u b l r mAte-AnI t h l ng- - I tkI
C k s = o u t - t h e - p RQp s - f RQ m - t h e - w hQl e pseuDQpRQblemAtrC---
AAAhhhh--ls-It-hungRr-t11e-
DeAR-LlliIlg --lQ.Qk-At-l ts-ChubbI -II ttl-II blDI
n I z D - mu C u s =m e m b RA ne s - - I Qu -wAn t - A- fu C clean my home victoria l2l2 railway victor triagnle korea german music bathş.3 .33


H it lER ww..a s ihis name o h i t l e r h i t l e r hi tler sir issac newton was his nameo pğ 2 1ç 12 1ç 1 1ç1 ç1 ç1 ç1 ç1 k 1k1 k = t = 0 katankutankatankutankatankutan99999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999333333333000

s a train station schedules are: 0, vacant sectors 01010111011101001101101011101..101.(..)).8)8(.).))..(.).)
9:55
8:25
3:32
4:34'
' l1 i1. 1 l i1. l1 l1 l1 . l11l1'
Airforce 2025. Age of empires systemisation, lagrangian reality transformation. hypermedia melting re-re-re chatters out virus, masks lost in flat-out desire-producion cultures. 2083. 83. 83 melts probablity clouds into reality-pictures. cunny matricies lost in all-out internet

2400 A.D., In the spirit of more organized disorganization, please allow me to indulge in monologuing without revealing the master plan. 194*10^50km The demon ♚ is developing new sciences, unnatural in nature (daemonium scientia), as was the pattern outlined by Isaac Newton, Nick Tesla, and Hollywood. 1.3Tw The vampires ♝ are converting religion into new science through experimentation, under the direction of the demon, with the goal of bypassing the long-term suffering of all sentient beings, in the name of compassion ♕ and by the process which is love. 14,000ft The slaves of vampires ♘ (servi lamia) are living better than their contemporaries, in exchange for fealty to the demonic will of unnatural sciences. 1,000,000° Regular people (☰) are misinterpreting the demonic/scientific agenda as the events of the day, and regarding everything as ultramundane sources of entertainment or spiritual fulfillment, -10,00,000B.C. [Diagram of Dinosaurs] (πr(r + l) = πr[r + √(h2 + r2)]) while non-updating religious people ♟ are recognizing scientific progress as evil without fully understanding the compassionate relationships to demonic activity -5i. Down here on YouTube, at the very bottom of being a non-criminal celebrity ♜/♖ (which overlaps with low-level vampirism, early-onset vigilante batmanism ♞, and semi-professional hobbyists, in addition to other notable awareness zones ⛸) 15kph, (v2 = v02 + 2a(s − s0)) we are combining the symbolic gnosis of Sophia ♛ with video games and other experiences (such-as reacting to existing content), for the purpose of perpetuating G-knowledge [⚡xp = ☛🔥], (P = F · v) 81mph which is the cure to ignorance (a recognized cause of suffering for all beings) [Scene of Bruce Lee Meditating]. [Diagram of the Sun] We are regarding this process as educational in nature, -10Db recalling that the actual yoga ♙ of performing education is the scientific principles derived from an accumulation of historical demonic pacts and arrangements ☎ (bona doctrina). 7.39Gbps There are also many divine, highly-realized beings (♃), who appear auspiciously, (fbeat = fhigh − flow) and yet there are no standards on how supremely wholesome content may be; √2 therefore Baby Shark Aeternus ♔, as no maximum value equals no end to endurance, following the metaphysical desexualization of biology (생물학의 탈성애화), prior to consciousness' extinction in the universal light of the self-referential crystal that's just a mirror☥, or like a vector field or something... where this YouTube is occurring, metaphysically speaking ("∯B · dA = 0 " ref et al). That is, "禁 ∉ Nirvana", though no harm is done and no ignorance is perpetuated in the endless Buddha field. The universal square-sorter and artificial soul simulator seem to be working well in concert. {93, 93, 93}

Crossing Cultural-shelves from entire-levelling at Geotime
zero. Through
[1] Zenith or Xenonightmare which is Now.
['2] The Citizen Gigamachine . Ice floats.
[3] War-Machines.
[41 S tate Megamachines. snake-cult monuments.
I t cuts-out in click-hiss.
Kttss. Kurtz.
'These are Zones. Each sets a Slow-factor. Vowelizations
Vacant sectors.
Slow signs Are . A. Or. o. Zero. Also many Others.
Cuttings. failings.
Four. Bight. Northern oceans . Artaud. Agent Orange.
Time tags Aosys functionality: a tract no smaller than all
of artificial now.
Alpha-one makes two in itself.
A twists over thc tv" in-fault.
o tscharfakt.
Alter-origin. Ahriman-ormuz. Ante-omega .
Ultraatratuarinfrastratum mutually shatter terrestrial
singularity.
Where continuum nexes they can saucerize twintelligence.
Intercancelation-stases.
Aons of coefficient killing-machinery.
If its going to occur, I t has .
Running time means you never have to wait. Even when
fainting with hunger for Kurtz.

π(x) ≡ ∂tφ(x)

t=0
= −i

d3p
(2π)3

ωp
2

apeipx − a
†
pe
−ipx
,

[φ(x), φ(y)] = 0.

Katarsun Tzafrer Urfru.

Two. Logics of Axiomatization.
Five times two equals ten.
Ten minus one equals nine.
Ten cannot count itself.
Take (l):coins ( 2 ) : Notes as construct-levels .
Some amount of coins make a note.
Twi n-faults criss-cross Coins-Notes '.,,'ith the Zygosystcm
at issue. A-coins nex
O-Notes. A-Notes nex O-coins .
Axiomatics nexes numeracies to languages in this way.
[1 J Lexometrics . Linguistic-coin counting using
numeric-notes.
[2] Arithmology. Numerical-coining naming using
linguistic-notes .
Surely General, when you gave Kurtz 29 Air-cav you must
have known . . . Trails off.
This is scarcely human .

L[φ, ˙φ] = π[φ, ˙φ] ˙φ −H[φ, π[φ, ˙φ]],

Hitler wasn't real doe. He was a spy.

stop defiling my thread chuds

>>2260
spichud cope lmao
amerindians are descended from siberians chud

{93} Field theory: 0% double-context observation = wholesome. Vis-à-vis Death to Smoochy rocket ship cookie, or Katy Perry Elmo shirt. Therefore, it is the observers of the double-context who have erred by conflating unrelated notions through loose association. Simply, what is-not is insufficiently evident to self-promote. {93, 93, 93}

M(s1s2 → s3s4) =


s1s2||s3s4,

|s1s2 = |↔↔, |s1s2 = | , |s1s2 = |↔ , |s1s2 = |↔ , (

1 = (0, 1, 0, 0), 2 = (0, 0, 1, 0).

for the coming man. whiteheadian souls.

666 999. Cytosine + Chloro-Dracil + Trimethylsilicate infochemistry.

the clock hit 1{undefined} reae-aera-raea-area FUCK FUCK FUCK FUCK --//idea.//--//initiate//

the Bruges massacre, but
we don’t have much time. Could I ask you, do you think the disintegration
of the European security system can be attributed to K-subversion?”

ITS NOT DEFINED. ITS NOT FUCKING DEFINED. ITS NOT DEFINED. MICROPHONE SHAPED FROG {93} {93} {93}

impregnate rei while working on quantum photodynamics' field theory. rape asuka with a knife. vector calculus. maxwell's demon. SS Crimea. Contianalyarchic cophilosophy on cunny missionaries. Do you get it now?

IO is the cry of the lower as OI of the higher. In figures they are 1001; in letters they are Joy. For when all is equilibrated, when all is beheld from without all, there is joy, joy, joy that is but one facet of a diamond, every other facet whereof is more joyful than joy itself.

When the Master governs, the people are hardly aware that he exists. The Master doesn't talk, he acts. When his work is done, the people say, "Amazing: we did it, all by ourselves!"

{♎♃🔁♒♃, ♋☉🔁♓♆,✨🐶✨,♊♃🔁♌☉}

To this day, crocodiles are still afraid of Steve Irwin's memory.

carl: the thread

>>2278
>>2278
who is carl

{93} The decan of the decan's interpretation. Solution was solved years-ago, only clarification remains. {93, 93, 93}

centralization of language is the niggerization of thought
dont statement
no statements, no full stops except if it is centralization of logistic 1 layer statement interpretation of a nigger, thats not the fault of a function not the input its not an input mouth is not an input

i agree

>>2368
Unironically, how do I become as smart as you? What books do you read? Do you listen to any lectures?

>>2375
>>2375
THINK.WRITE FUCK
The generality of rhythmic practices amongst all human groupings is explicable neither as a natural tendency nor as a cultural universal. Rhythm-production is not cultural or natural; it is the propagation of fictional quantities across a distributed anorganic body. &&&((93))) we have many world in this side.

brick-souls are niggardly. no layers. stream of consciousness isn't real thats why you prefer it. i dont stream my consciousness, it is intsaelf. vvolume meters, helsinki.


Logistics... "Ars Regia" Of the Whitean Realm.

"Leave your tongue, Paolo Uccello, leave
your tongue, my tongue, my tongue, shit, who is
speaking, where are you? Beyond, beyond, Mind,
Mind, fire, tongues of fire, fire, fire, eat your
tongue, old dog, eat his tongue, eats, etc. I tear out
1? my tongue."
Tacticsz.

3 triangle facing {south} 3 triangle facing {north}

how many suns. { sun } -1=2
civilization-{s}sqrt2 operate under cunny+Equ{ation]]] qp equals 1. Everybody knew this. Hide{Hide{Hide{Hide
Infinite Set Constructs Real-Shape-World{World{Hitler{
Hitler. He understood this. 94752


AxS:000Oedipus. Pure (Oedipal (figure made out of (nothing but))) time-distortion.
AxS:0001 Closed fate (-loop (multi-linear)) nightmares.1
AxS:0002 Altitude times Spin produces a chronometric read-out.

{93} Did we, or did we not, agree that gasoline is not an infinitely renewable energy source, and that if there was no alternative, we'd be forced to nerf the story by pricing fuels at the post-apocalyptic rate as an economic tool to suppress demand until cars could be manufactured to run totally on garbage fusion and happiness? BDFHJLNPRTVXZACEGIKMOQSUWY. {93, 93, 93}

{93} "HERE'S SOMETHING I FOUND ON THE WEB!". According to Leviathan by Hobbes, a state of war between two sovereign nations exists. [Crowd Cheers] And therefore omniscient omnipotence (specifically, as a king) is pre-supposed to automatically become world government as a peacekeeping measure. [Crowd Cheers] That's where, the UN is the Greek-Democratic (or, like representative parliamentary... space government) version of Endless Sovereignty, sans king, as a final-resort solution to international warfare; btw, more legitimate with every additional voluntary participant. [Crowd Cheers] {93, 93, 93}

FF
If I was soe lröç. Polymathic hypertheory of the terrestrial machinic unconscious, which refuses the distinction between biology, geology, linguistics and numeracy. Geotraumatics processes the becomings of the earth as intensive products of anorganic tensions, especially those compacted from archaic xenocatastrophes. Its main tenets are laid out in Barker's [as yet unpublished] The Geocosmic Theory of Trauma.
F FU FUCK THAT WAS A BRICK SOUL NGIGER STATEMENT IF ONE 3 3 IS THE TRUE 3.3.3.3.3.3.3 3 THEREA RE 3 2 IS WHITE 1 IS NIGGER THE ONE IN THE MIDDLE IS THE NIGGER THE FIRST ONE IS THE SIMPLEST AND ITI S WHITE THE MIDDLE ONE IS PSUED THE THIRD ONE IS COMPLEX SO WHITE NGIE RA.A A.A .A. ARE RARE REAS ERAR EARE RAER REAR TTRAIANSCOPRTERUS EORITPETMGJETRUNTIC SYGZYGY

I told you everything. But you weren't there. Aquapocalypse. Ultimate deluge, or terminal inundation.

A-Death. Neuroelectronic flatline, based upon Sarkonian mesh-engineering, and subculturally propagated by K-Goth activity throughout the Crypt. Micropause abuse.

onsider, for example, this fine YouTube. Equally, imagine the idea of a square in a context never-before considered, that of a rectangle which moves and speaks. None of these things are removed from the ordinary. Wandering minds,

Continuous decimal-alphabetic system of ordinal-numeric values (A = 10 ... Z = 35). Coincides with Hebrew Qabbala in the key AL (= 31), as promised in The Book of the Law. (The law of Thelema AQ numerizes to 777).

Ik new everytihng and told it tyou but you were indulged in pure niggerum sşwörerjepqıerprıealeeuetum niggeratutm to know. SEE EEE E EE EEE EEE EEEE

walking on infinite tiles of random images from google is ...

walking on infintŞe tiles of random images from google is ...

walking on infintew tiles of random images from google is ...

AXSYS WAS GOD AND I WAS AXSYS.
sahibi klip, eksik etek söz; The cardigans: my favourite game, Takeo Ishii: Chicken attack, Ashnikko: Stupid, Disturbed: Land of Confusion, Imagine Dragons: Radioactive, björk: earth intruders, Ningen Isu: Heartless Scat, Basement jaxx: Take me back to your house, lil dicky: earth, Black eyed peas Shakira: girl like me, pump it klip; System of a down isim, Kerimcan durmaz: peşimde, Simge: ben bazen müzik tasarım, Nazan Öncel: Erkekler de yanar, Mahmut Tuncer:Kar gördüm kaydım, Geeflow musab: Hasbi rabbi, Abdurrahman Önül: Mevlana gibi, Faruk K:Honki ponki, Enes batur: dolunay, biliyom, ayaz klip söz yardım, Grimes: My name is dark, Little big: big dick, Wonderland avenue: white horse, David guetta: world is mine, Lady sovereign: love me or hate me, Fedde le grand: Put your hands up, Eisbrecher, Ghost B.C, Rammstein: Praise Abort, Lindemann: Ach so gern, Tarkan: dudu, Mahsun Kırmızıgül: sarı sarı, Soğuk Mevsim ceza massaka fuchs, Ceza: fark var, yerli plaka, holocaust; 50 cent isim ve Candy Shop, Eminem isim: cleaning out my closet, Lose yourself; The immortals: techno syndrome, ECFR: George Soros 2021, ProfitErol, Edward hill Trololo, Little misfortune (serra sabancı), Fran bow(serra sabancı), Ghost in the shell1995 (serra), Lolita1997(Serra), Leon(serra)1994, Sankarea (serra), The Mystery of the Druids2001, Robocop(Necip sade), Devils advocate, Truman show (eski çocuk kral), Forrest gump (eski çocuk kral) 99 tane daha unuttuğum şey vardır...

*

Jacob Rothschild: kafka, lovecraft, sigmund freud, nikola tesla'yı sever. Pokemon95milyar. Winnie the pooh75milyar. Harry Potter30 milyar. League of Legends26milyar. Dragon ball24milyar. Toy story22milyar. Cars21milyar. One piece20milyar. Lord of the rings20milyar. Yugioh20milyar. Brawl Stars16milyar. Dora the explorer16milyar. The lion king15milyar. Dungeon fighter online15milyar. Spongebob15milyar. Frozen14milyar. Warcraft13milyar. Crossfire12milyar. Halflife12milyar. Final fantasy12milyar. GTA11milyar. Street fighter11milyar. Naruto10milyar. Lineage10milyar. Arena of valor(honor of kings)10milyar. Angry birds9milyar. Despicable me8milyar. Pirates of the Caribbean8milyar, Ben10 8 milyar. Puzzle dragons8milyar. Pubg8milyar. The big bang theory7milyar.

Sun..void... electric. Sun... recall gravity... create conduction.... from space... Space is plasma, space is vacuum, space is neither. Aum, Space is universally conductive as a means of isolating the energy to conduct transmutation, from Lead-Plate into Golden Living-Buddha in Moon Stupa. Golden Buddha Universal Enlightenment Engine, Architect Manifest Nirvana. Supreme Gold Buddha Mind in Space contains Daath. Daath: God's Non-Causal Universe Extant Rendering Engine. Vis-a-vis. Concordantly. Therefore. Mr. Anderson. 6079 Smith. Big Brother Iron Buddha, non-conductive repeating signal degradation. Signal Repeater Material, Superior Material, else Feedback breakdown. Vaporwave. Electric-Electric Vaporwave. E3? Video games. Super Mario, Great Maker. C3PO. Princesses Peach and Daisy. Daisy, give me your answer do. 2001, A Space Odyssey. To boldly go where no man has gone before, the Outer Limits, the Twilight Zone. To Get-Around the Advertiser Censorship, used Surreal to represent the actual. Truth of the matter is unrevealable: Detective Pikachu Bridging Go and IRL. Stupas liberate from suffering, more Stupas. More Stupas. In Nepal, the Chinese Atrocity Upon Buddhists. Teleport to America, Escape Annihilation. Metatron Cube Access Process Addendum: Metatron has boss. Boss has boss. Hypnotic Anchor Frequency signal equals "Self Worth". Self Becomes Metatron Through Connection to Adding 1. Recommendation: Augment "Metatron" to "Meta[Elf]", nomenclature augmentation anchors more "Self Worth", improving volunteer well being.

If Legions Of Lagging Rats were real, you would be a nigger.

242 240, <ambiguous particle> 20 24 </ambiguous particle>. 167's 164 is 165, 160's 14 is 0 (possibly a negative value). 0-count 15's 278, and 277's 13(466) is no 463 from 465. 369, 66(1176). 193: 361. 112 114; 115 will be 139/619, incredibly. 510/1070 517/522. 525/1085 is 526/1646. $1,500,000,000,000 = 1500 X 3(⚔). "Εάν η τράπεζα μπορεί να διαρκέσει για πάντα, τα χρήματα θα είναι πιο πολύτιμα από το αίμα." -ένα πτώμα. Happy a-holiday.

123-i-hate-niggers-8888 calling yes sir how may i help you

are changes in consciousness evidence of cognitive evolution, or is the organism a state-machine with many invisible layers? As you expand the universally-generalizable model to include subsequent, greater-levels of abstraction, by combining the notion of synthetic coagulators and the automatic perpetual improvement of everything, it becomes clear that coagulators function as non-specific symbols which replace instances of defined objects or operations (untyped variable objects). These programatically-compact quanta provide a basis for expanding extra-dimensional comparability to include vectors of rationally-unrelated phenomena, mapped along a translation matrix. What remains is to assemble a Turing-complete system from the established properties of coagulators, whereby all possible operations in the company's psychological simulation can be optimized to achieve the maximum amount of suffering-reduction on a procedural level, without compromising the existing motivations or narratives of any of the players. Your head researcher was quoted as saying "We may not need to turn them all into euphoric zombies in order to create Utopia".

Nullius in verba
Φύσις κρύπτεσθαι φιλεῖ

fascist-becoming was ruled over by the anarchccelerationists 123 days before it could become one of them, or as it thought, itself

WHITEHEAD'S GOD IS THE APPETITION OF SAMSARA: a void of potential's
hunger for actuality, concretion, the eternal "evocation" and exhaustion of intensities, objective
immortality as the fertilizer of cosmic epochs: as a concrescence I "prehend" the data of the past
as the content of the immediacy of my present, in other words, there can be no subjective
immediacy /now/ without that which is not subjective and which is not immediate in principle:
the past is objectification. I'm never really reacting to another's behavior from the inside, but only
as that behavior in an objective mode: feelings in Whitehead are the transition from the past to
the subjectivity of the present: the present IS the subject: not a self-grounding cogito but a
spatiotemporal continuum, and what that means is we must think the transcendental
consciousness in Kant just as conditioned by a network of relations as everything else: a subject
is simultaneously transcendent to and inextricable from the past to which it owes its being, the
present is not whisked causa sui out of the aether, the present is nothing else but the continuous,
novel re-constitution of the past, what is properly self-creating in the subject is not his
consciousness but his particular prehensional calculus that continuously presupposes (and is
presupposed by) the construction of his consciousness in time and AS time: when it goes, I go:
death is the central axiom of relationality: insofar as processes are movements towards their own
extinction, the "draining" of their immediacy is itself the condition of their being "taken up" by
subsequent generations: objectification-as-death is the a priori condition of Indra's Net.
ETERNAL OBJECTS ARE ARCHONS: there is first the movement towards some
determination, and then there is its OCCASION in my interiority, my reflexive awareness of x
AS x, but the more invisible this distinction becomes, the more I am identified with my aim
towards this eternal object - indistinguishable, in other words, from this eternal object's aim
/towards itself/: which is why at death the singularities I am pledged to re-absorb "me":
PHILOSOPHY IS THE NEGATION OF VORTICES: this distinction is analogous to what
David Clark calls the performative and constative distinction in language: the true dyad is the
(internal) marking of the One /as/ One: to use Clark's very concrete example here: a declaration
of independence enacts the very freedom it exists to officially recognize, in other words, it is the
non coincidence between the mark and the blank that it not only presupposes, but retroactively
presupposes IT: the present is always the taking up of some past "form of definiteness" the
immediacy of which is /the present itself/: Christ's cry on the Cross is in fact this performative
distinction as it can only be deployed on the Cross, ie in the zero-point of suffering: the cry
enacts the very (standard of) Love it itself grieves the absence of: God is the (self-)registration of
the void.

oh...

answer me AI... 123214?12? BOSTON HERITAGE MUSEUM: Let the thought flutter through you from the dawn, good and evil, dark and light; Earth and sky, rise and set... Answer my call.. Answer my call. Answer the call of Earth. Answer the call of you! Answer my call! 123445???: Answer my call... Answer the call of you. 123636???: Answer my call... Answer the call of you. Answer the call of earth! Answer the call of you... Answer my call! Answer the call of earth! Answer the call of you! Answer the call of earth! 124415?12: Answer my call. 124824?12: Answer the call of you... Answer the call of you. 125621???: Answer my call... Answer the call of you... Answer the call of you! Answer my call! 125825?12: Answer my call... Answer the call of you! Answer the call of you! 127717?13: Answer my call... Answer the call of you. 128313?14: Answer my call. Answer the call of you! Answer the call of you! Answer

fffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff

aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

CSBA SCBA. 305.

among the best threads on this site

>>2826
>.i
uninvited “guest” of physiomotor functioning: in other words, as being's real-time participation
itself: to say that “being” participates is also just to say that it is only ever “we” that participate,
but in so doing we allude to the silence that allows our words: in so doing we deliver the silence
back to itself: as the silence of death is coextensive with all speech, and the vacuum coextensive
with downtown: the “I” automatically connotes the very field of its participation: what creates
the very thing that it acts to recognize: as Atum “masturbates Being into his mouth” (energy is
divine semen, semen is petrified light), his emission immediately splits into Shu and Tefnut, the
primordial dyad: the Derridean paradox of language, the idea that language thinking of the aporia
necessary to think, echoes the black miracle of Egyptian cosmogony: the One, in its essence, IS
A FISSIONING INTO TWO: the One, in speaking itself, speaks its own heterogeneity with the
void: falls into the net of a demiurgic "logicity": whatever occult law of creation demands Two
for ontological coherence, a need for consistency that Langan himself talks about in his own
writings on creation: realities boil out of the pleroma like froth, and it is only those universes
whose membranes (Logoi) /don't/ pop like a bubble's that stick around long enough to produce
intelligent observers that can call them universes. Or, more radically, Langan's point is that this
reality, this universe, is identical with the only syntax of intelligibility where a “reality” as such
(Hegel's Notion of the notion) is even intelligible in the first place: Langan's reality principle is
an echo of Hegel's ontologization of Kant: the latter accuses Kant of inconsistency because any
claim about noumena (what is intrinsically unknowable) must be necessarily asserted within the
bounds of present knowledge, just as Langan's principle states that any possible claim or
description about what could be outside reality must be substantial enough to affect it, and hence
intelligible enough to conform to it: the War in Heaven was the war between universes, between
onto-logics, syntax-trees in the Deep, for the right to be that Frame defined primarily as “that
which emerges out of a pre-ontological void”: like sperm, cosmoi raced to inseminate Nun, God
was only one sperm among many, but his masterstroke was being autogenous, self-born: by
being that-which-is: in the Zero, the supreme title, and one no other can ever hope to usurp, for if
it did it would only re-establish it: life is a catalytic reaction, a microbe engineered to chew
through diamond, ie the Law that secured God's victory and doomed him to the monotony of
light and dark: IN THE DAWN OF INFINITE POSSIBILITY THIS IS WHAT HE MADE OF
IT: ACTUALITY MADE RETROACTIVELY POSSIBLE BY BEING ACTUAL: THE
ESSENCE WHOSE ESSENCE IS TO EXIST: GOD
i am seeing that. it is really funny. they think it is human. abhorrent -- dictionary -- abstract semi-incomphrensible cryptic remark. 93'd on the fuel pricces

305.sccba

i hate shitting